Dataset: Methane seep 16S rRNA sequences
Deployment: MBARI_Southern_California_2013

16S rRNA gene sequences of cells in marine methane seep sediments

Principal Investigator:

Roland Hatzenpichler (Montana State University)

Contact:

Roland Hatzenpichler (Montana State University)

BCO-DMO Data Manager:

Amber D. York (Woods Hole Oceanographic Institution, WHOI BCO-DMO)

Project:

Activity-based cell-sorting and enrichment of newly synthesized proteins via amino acid tagging and click chemistry (Cell-sorting and enrichment)

Version:

Version Date:

2016-10-25

Data URL:

https://osprey.bco-dmo.org/dataset-deployment/662735/data

Expand/Collapse All

Description

This dataset contains 16S rRNA gene sequences accession numbers from isolated microbial aggregate from marine methane seep sediments.

These data were published in:

Hatzenpichler, Roland, et al. "Visualizing in situ translational activity for identifying and sorting slow-growing archaeal− bacterial consortia."Proceedings of the National Academy of Sciences 113.28 (2016): E4069-E4078. doi:10.1073/pnas.1603757113

Methods & Sampling

Dataset acquisition description

Environmental Sampling and Storage (extracted from Hatzenpichler et. al., 2016)

R/V Atlantis cruise AT-15-68:

Sediment sample #3730 was obtained from Hydrate Ridge South methane seep field (Alvin Dive 4635; push-core 16; 44 deg 34.09 N,125 deg 9.14 W; 775 m water depth; sediment horizon 0–6 cm; 4C in-situ temperature) on 7 August 2010. Sediment was stored underargon headspace in a Mylar bag for 5 wk before being transferred toa 1-L glass bottle with a 1.38 bar 100% methane headspace, which was stored at 4C for ~4 years. Seawater and headspace were exchanged at regular intervals to prevent the accumulation of inhibitory compounds.

MBARI Cruise 2013 "Southern California"

Sediment sample #7142 was collected from Santa Monica Basinon 7 May 2013 (R/V Western Flyer MBARI Cruise 2013; dive 459; push-core 74; 33 deg 47.34 N, 118 deg 40.09 W; 863 m depth; sedimenthorizon 4–6 cm; 4C in situ temperature). The sediment was sealed under argon and stored at 4C. After 40 days of storage, the sediment was suspended in anaerobic natural bottom seawater from the site in an anaerobic chamber (3% H2 in N2) and aliquots were overpressured with 1.5 bar methane. The sediment was kept for 12 months under 1.5 bar 100% methane in natural bottom seawater that was exchanged every 3 mo.

All Sample Handling:

All samples were kept in an ice bath at all times during handling. Artificial seawater (ASW) consisted of 10.9 g of MgCl2·6H2O, 0.2 g of NaHCO3, 0.76 g ofKCl, 25.9 g ofNaCl, 1.47 g of CaCl2·2H2O, 3.98 g of Na2SO4, and 26.73 mg of NH4Cl per liter of ddH2O at pH 7.4. One milliliter of vitamin solution (see medium 141, https://www.dsmz.de) and 1 mL of trace element solution SL- 10 (see https://www.dsmz.de) were also added. Before use, ASW was filtered through a 0.2-μm filter and N2-bubbled for 10 min. ASW was kept on ice during handling. For more information on resuspension and incubation procedures used see Hatzenpichler et. al., 2016.

Deployment-specific acquisition description

R/V Western Flyer MBARI Cruise 2013; dive 463; push-core 43

R/V Western Flyer MBARI Cruise 2013; dive 459; push-core 74

Data Processing Description

Dataset Processing Description

16S rRNA Gene Tag Sequencing (extracted from Hatzenpichler et. al., 2016)

Sediment DNA was extracted using the Power Soil DNA Isolation Kit according to the manufacturer’s protocol (MoBio), and diluted DNA from genomeamplified sorted consortia was used directly. The V4 region of the 16S rRNA gene was amplified from each extract using archaeal and bacterial primers 515F (GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT) (67, 68). Sediment samples were amplified in duplicate. The nonbarcoded primers were used with Q5 Hot Start High-Fidelity 2× Master Mix (New England Biolabs) according to the manufacturer’s directions, using annealing conditions of 54 °C for 30 cycles and 58 °C for 32 cycles for sediments and MDAs, respectively. Duplicates of sediment sample amplifications were then pooled. The barcoded 806R primer (CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT) was paired with 515F in a reconditioning reaction (same conditions as above except for five cycles of PCR) to barcode the PCR products. Samples were mixed together in equimolar amounts and purified in bulk through a Qiagen PCR purification kit before submission to Laragen for analysis on an Illumnia MiSeq platform. The resulting paired-end sequence data, 2× 250 bp, was demultiplexed, and sequences with >1 bp mismatch on the 12-bp barcode were removed. The resulting sequences were passed through Illumina’s MiSeq Recorder software to assign quality scores to each base call and remove adapter, barcode, and primer sequence.

Information on the fluorescence activiated cell sorted microbial aggregate composed of ANME and SRB, and other probe information can be found in Hatzenpichler et. al., 2016

Data Manager Notes:

several columns in submitted dataset removed and included in metadata such as publication information.
converted lat/lon from degrees decimal minutes to decimal degrees.
added underscores in some text fields
removed units from data colums. Units can be found in the parameters section.

More information about this dataset deployment

Funding

Award Number	Funding Source
OCE-0939564	NSF Division of Ocean Sciences

Instruments

None available yet

Parameters

Supplied Name	Supplied description	Supplied Units	Standard Name
cruise_id	Cruise Identifier	unitless	cruise_id
dive_id	Dive ID that collected the sample	unitless	dive_id
collection_date	Date of sample collection	unitless	date
accession_number	Accesssion number for sequence	unitless	accession_number
accession_link	Link to accesssion information at NCBI	unitless	external_link
organism	Organism description	unitless	sample_descrip
lat	latitude	decimal degrees	lat
lon	longitude; west is negative	decimal degrees	lon
water_depth	Water depth at sampling location	meters	depth_w
sediment_depth	Sample sediment depth	centimeters	depth_bsf
collection_source	Description of collection location	unitless	sample_descrip

Database

Contribute Data

Dataset: Methane seep 16S rRNA sequences
Deployment: MBARI_Southern_California_2013

Dataset acquisition description

Deployment-specific acquisition description

Dataset Processing Description

Database

Contribute Data

Dataset: Methane seep 16S rRNA sequencesDeployment: MBARI_Southern_California_2013

Dataset acquisition description

Deployment-specific acquisition description

Dataset Processing Description

Dataset: Methane seep 16S rRNA sequences
Deployment: MBARI_Southern_California_2013