Dataset: Diatom amplicon sequencing variants from Narragansett Bay 2008-2014

Name: Diatom amplicon sequencing variants (ASVs) from Narragansett Bay, Rhode Island, USA from 2008-2014
Published: 2023-11-09
Keywords: phytoplankton, Metabarcoding, time series, oceans

Cite This Dataset

DOI:10.26008/1912/bco-dmo.911102.1

Spatial Extent: N:41.57 E:-71.39 S:41.57 W:-71.39

Temporal Extent: 2008-12-09 - 2014-12-30

Project:

Dimensions: Collaborative Research: Genetic, functional and phylogenetic diversity determines marine phytoplankton community responses to changing temperature and nutrients (Phytoplankton Community Responses)

Narragansett Bay Long-Term Plankton Time Series (NBPTS)

Northeast U.S. Shelf Long Term Ecological Research site (NES LTER)

Program:

Dimensions of Biodiversity (Dimensions of Biodiversity)

Long Term Ecological Research network (LTER)

Principal Investigator:

Tatiana A. Rynearson (University of Rhode Island, URI-GSO)

Student:

Diana Nicole Fontaine (University of Rhode Island, URI-GSO)

BCO-DMO Data Manager:

Shannon Rauch (Woods Hole Oceanographic Institution, WHOI BCO-DMO)

Version:

Version Date:

2023-11-09

Restricted:

Validated:

Yes

Current State:

Final no updates expected

Diatom amplicon sequencing variants (ASVs) from Narragansett Bay, Rhode Island, USA from 2008-2014

Abstract:

These data include diatom composition information from a fixed sampling site in Narragansett, Bay, RI, USA over six years between dates 2008-12-09 and 2014-12-30. Sampling occurred monthly from 2008 to 2013 and twice per month in 2014. Diatom composition data, in the form of amplicon sequencing variants, were obtained via high throughput sequencing of filtered biomass samples. Diatoms are important contributors to marine primary production; however, their vast diversity makes species-level identification challenging. This dataset, collected over many years, includes diatom composition data at a more detailed level than ever before observed in Narragansett Bay and highlights the importance of time series for understanding phytoplankton dynamics in coastal systems. These data were collected by various students over the years with supervision from Dr. Tatiana Rynearson of URI's Graduate School of Oceanography. Diana Fontaine processed these data and together, Dr. Rynearson and her student Ms. Fontaine published their results in Limnology and Oceanography.

Expand/Collapse All

Archival Copy

Version Date	Archive	Persistent Identifier (PID)	Date PID Issued
2023-11-09	Marine Biological Laboratory/Woods Hole Oceanographic Institution Library (MBLWHOI DLA)	10.26008/1912/bco-dmo.911102.1	2023-11-09

Methods & Sampling

The methods reported below are summarized from Rynearson et al. (2020) and Fontaine and Rynearson (2023), two publications that used this dataset.

Filtered biomass sample collection, processing, and sequencing
As part of the Narragansett Bay Plankton Time Series (NBPTS), weekly surface water samples (9 meters depth) were collected between December 2008 and December 2014 from the west passage of Narragansett Bay (41°34.2'N, 71°23.4'W), a partially mixed estuary in the northwest Atlantic. Sampling occurred at a fixed location (historically this station has been called 'Station II') with a small boat operated by the University of Rhode Island (Cap'n Bert).

Water samples were filtered in triplicate onto 0.22-micrometer (μm) pore size, 25-millimeter (mm) diameter ExpressPlus filters (MilliporeSigma, Burlington, Massachussetts, USA) and stored at -80° Celsius (C) for later DNA extraction. Filter volume was dependent on the in situ Secchi depth; 100 milliliters (mL) of water were filtered per 1 meter (m) of Secchi depth which ranged from 1- 6 m. Previously extracted DNA from 68 monthly surface water samples collected between December 2008 and December 2014 was used here (Canesi and Rynearson, 2020) in addition to extracted DNA from 12 monthly samples collected between January and December 2014 (Rynearson et al. 2020).

To identify the diatoms present in each sample, a 420 base pair (bp) fragment within the variable V4 region of the 18S rDNA gene was amplified using primers D512 and D978rev (Zimmermann et al. 2011). Primers were modified by the addition of Illumina-specific adaptors: D512_illumina: 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATT CCAGCTCCAATAGCG 3' and D978_illumina: 5' GTCTCGTGGGCTCGGAGATGTGTATAA GAGACAGGACTACGATGGTATCTAATC 3'. Ten microliter PCR reactions contained the following reagents: 1x Bio-x-Act Short Mix (Bioline USA Inc., Taunton, Massachusetts, USA), 0.5 micromolar (µM) each forward and reverse primer and approximately 0.3-2.7 nanograms (ng) DNA template. Reactions were amplified with a multi-step thermocycler protocol, consisting of a two-minute denaturing step at 94°C, followed by 20 cycles of 30 seconds each at 94°C, 49°C and 72°C, followed by 15 cycles of 30 seconds each at 94°C, 67°C and 72°C, followed by 10 minutes at 72°C. PCR amplicons were cleaned with Ampure XP beads (Beckman Coulter, Inc., Brea, California, USA), quantified with the Qubit High Sensitivity DNA Assay Kit (Thermo Fisher Scientific, Inc., Waltham, Massachusetts, USA), amplified for an additional five cycles to add Nextera indices and adaptors (Illumina, Inc., San Diego, California, USA) and cleaned again with Ampure XP beads. PCR products were pooled with the KAPA qPCR kit (Kapa Biosystems, Wilmington, Massachusetts, USA) and sequenced on the Illumina MiSeq platform with V2 chemistry (2x250bp reads; Illumina, Inc., San Diego, California, USA) at the University of Rhode Island Genomics and Sequencing Center.

Raw sequence data can be found on NCBI under BioProject number PRJNA327394 (https://www.ncbi.nlm.nih.gov/bioproject/327394).

Sampling Gaps:
Samples were not collected In February, March, April, and December 2012.

Data Processing Description

Sequence analysis and taxonomic assignment
To ultimately assign taxon identity to each read, paired-end sequencing reads were first processed using Cutadapt (Martin, 2011; version 2.10) to remove primers and Illumina adaptors. Reads were then processed and taxonomically assigned using the Divisive Amplicon Denoising Algorithm (DADA2) R package (Callahan et al. 2016; version 1.16). Forward (F) and reverse (R) reads were trimmed (F: 220 nucleotides (nt) and R: 210 nt), filtered (maxEE = F/ R: 2, truncQ = F/R: 2), denoised, and merged. Chimeras were removed using the consensus method in DADA2 (Callahan et al. 2016). Taxonomy was assigned to amplicon sequence variants (ASVs) using a naïve Bayesian classifier algorithm (Wang et al. 2007) with a minimum bootstrap confidence of 80% using the Protist Ribosomal Reference database (Guillou et al. 2013). ASVs that were identified to the same species were retained as separate ASVs here because the primers we used amplify a region of the 18S rRNA gene that has been shown to predominantly recover differences among species and not strains (Zimmermann et al. 2011). For ASVs where no species level information could be obtained, the species was reported as "Genus sp#" (e.g., "Chaetoceros sp1").

An additional taxonomic assignment step was performed using the assignSpecies function (Callahan et al. 2016) to allow for a single ASV to be assigned multiple species which resulted in some ASVs being classified as species groups because their sequences were not unique at the V4 region of the 18S rRNA gene. For Skeletonema and Thalassiosira ASVs, assignment of these sequences was performed upon manual examination of ASV sequences in Geneious (Kearse et al. 2012). The sequences were compared to a custom reference database for Skeletonema and Thalassiosira and taxonomies were assigned with 100% identity (Canesi and Rynearson 2016; Rynearson et al. 2020; accessible under DOI 10.5281/zenodo.10067598). The final dataset contained only ASVs that made up more than 0.075% of total sequence reads per sample, a threshold based on mock community analysis to determine spurious ASVs (Reitmeier et al. 2021).

BCO-DMO Processing

- Imported original file "Diatom_ASV_Table_V2.csv" into the BCO-DMO system.
- Flagged 'NA' as a missing data value. Missing data are blank/empty in the final CSV file.
- Created columns for Longitude and Latitude and filled in with the coordinates of the sampling locations provided in the metadata.
- Renamed the "Sample" column to "Sample_Date".
- Saved the final file as "911102_v1_diatom_asvs_narragansett.csv".

Data Files

File
911102_v1_diatom_asvs_narragansett.csv (Comma Separated Values (.csv), 521.80 KB) MD5:f7f6736d0f4117342ca8332a477da061 Primary data file for dataset ID 911102, version 1.

More Information about this dataset

Funding Sources

Funding Source	Award Number
NSF Division of Ocean Sciences	OCE-1638834
NSF Division of Ocean Sciences	OCE-1655686

Deployments

None available yet

Instruments

Automated DNA Sequencer

Supplied Name: Illumina MiSeq platform

Supplied Description:

Instrument Type

Generic Name: Automated DNA Sequencer

Acronym: Automated Sequencer

Generic Description:

A DNA sequencer is an instrument that determines the order of deoxynucleotides in deoxyribonucleic acid sequences.

Niskin bottle

Supplied Description:

A Niskin bottle was used to collect surface water in the field.

Instrument Type

Generic Name: Niskin bottle

Community Identifier: http://vocab.nerc.ac.uk/collection/L22/current/TOOL0412/

Generic Description:

A Niskin bottle (a next generation water sampler based on the Nansen bottle) is a cylindrical, non-metallic water collection device with stoppers at both ends. The bottles can be attached individually on a hydrowire or deployed in 12, 24, or 36 bottle Rosette systems mounted on a frame and combined with a CTD. Niskin bottles are used to collect discrete water samples for a range of measurements including pigments, nutrients, plankton, etc.

Thermal Cycler

Supplied Name: Eppendorf Mastercycler EP Gradient

Supplied Description:

Instrument Type

Generic Name: Thermal Cycler

Generic Description:

A thermal cycler or "thermocycler" is a general term for a type of laboratory apparatus, commonly used for performing polymerase chain reaction (PCR), that is capable of repeatedly altering and maintaining specific temperatures for defined periods of time. The device has a thermal block with holes where tubes with the PCR reaction mixtures can be inserted. The cycler then raises and lowers the temperature of the block in discrete, pre-programmed steps. They can also be used to facilitate other temperature-sensitive reactions, including restriction enzyme digestion or rapid diagnostics.

(adapted from http://serc.carleton.edu/microbelife/research_methods/genomics/pcr.html)

Parameters

Date and time formats are described in python strftime() syntax.

Supplied Name	Supplied description	Supplied Units	Standard Name
Sample_Date	Sample date Format: %Y-%m-%d	unitless	date
Year	Sample year Format: %Y	unitless	year
Month	Sample month Format: %m	unitless	month
Week	Sample week. Week number can be used to cross-reference the environmental data in the "Narragansett Bay Plankton Time Series" dataset (https://www.bco-dmo.org/dataset/874956)	unitless	time_point
Latitude	Latitude of sample collection location. Positive values = North.	decimal degrees	lat
Longitude	Longitude of sample collection location. Negative values = West.	decimal degrees	lon
ASV	Amplicon Sequence Variant (ASV) obtained from sequence processing	unitless	sequence
Kingdom	Taxonomic kingdom	unitless	kingdom
Supergroup	Taxonomic supergroup	unitless	taxon
Division	Taxonomic division	unitless	taxon
Class	Taxonomic class	unitless	class
Order	Taxonomic order	unitless	order
Family	Taxonomic family	unitless	family
Genus	Taxonomic genus	unitless	genus
Species	Taxonomic species	unitless	species

Status message

Database

Contribute Data

Dataset: Diatom amplicon sequencing variants from Narragansett Bay 2008-2014